'Motor neurone disease' redirects here. For the broader group of diseases, see. Amyotrophic lateral sclerosis Synonyms Lou Gehrig's disease, Charcot's disease, motor neurone disease (MND) An with increased in the posterior part of the which can be tracked to the consistent with the diagnosis of ALS Symptoms,, gradually worsening weakness Difficulty,, Usual onset 50s–60s Causes Unknown (most), inherited (few) Based on symptoms Treatment Medication, Prognosis Life expectancy 2–4 years Frequency 2 per 100,000 per year. [] Amyotrophic lateral sclerosis ( ALS), also known as motor neurone disease ( MND) and Lou Gehrig's disease, is a specific of which control.

Some also use the term for a group of conditions of which ALS is the most common. ALS is characterized by,, and gradually worsening weakness due to.

This results in difficulty,, and eventually. The cause is not known in 90% to 95% of cases. About 5–10% of cases are from a person's parents. About half of these genetic cases are due to one of two specific. The diagnosis is based on a person's signs and symptoms with testing done to rule out other potential causes. No cure for ALS is known.

A medication called may extend life by about two to three months. May result in both improved quality and length of life. The disease usually starts around the age of 60 and in inherited cases around the age of 50.

The average survival from onset to death is two to four years. About 10% survive longer than 10 years. Most die from respiratory failure. In much of the world, rates of ALS are unknown. In Europe and the United States the disease affects about two people per 100,000 per year.

Official Full-Text Paper (PDF): Individualized current-shaping reduces DBS-induced dysarthria in patients with essential tremor. To investigate in patients with essential tremor (ET) treated with thalamic/subthalamic deep brain stimulation (DBS) whether stimulation-induced dysarthria (SID). We waited at least 5 minutes. Jul 12, 2013. We determined the repeat size in a total of 889 clinically ascertained patients (including PD and essential tremor plus Parkinsonism (ETP)) and 1144 controls using a repeat-primed PCR assay. We found that large C9ORF72 repeat expansions (>30 repeats) were not contributing to PD risk.

Descriptions of the disease date back to at least 1824. In 1869, the connection between the symptoms and the underlying neurological problems was first described by, who in 1874 began using the term amyotrophic lateral sclerosis. It became well known in the United States in the 20th century when in 1939 it affected the baseball player and later worldwide following the 1963 diagnosis of. In 2014, videos of the went viral on the internet and increased public awareness of the condition.

Contents • • • • • • • • • • • • • • • • • • • • • • • • • Classification [ ] ALS is a, also spelled 'motor neurone disease', which is a group of that selectively affect, the cells that control of the body, including amyotrophic lateral sclerosis (ALS),,,,, and. ALS itself can be classified a few different ways: by how fast the disease progresses (slow vs fast progressors), by whether it is inherited or sporadic, and by where it starts. Most commonly (~70% of the time) the limbs are affected first. In this case, neurons in the brain () and in the spinal cord () are dying and this form is called 'limb onset'.

In about 25% of cases, muscles in the face, mouth, and throat are affected first because motor neurons in the part of the brain stem called the (formerly called the 'bulb') start to die first along with lower motor neurons. This form is called 'bulbar onset'. In about 5% of cases muscles in the trunk of the body are affected first. In all cases the disease spreads and affects other regions.

The symptoms may also be limited to one spinal region. Those with leg amyotrophic diplegia and brachial amyotrophic diplegia have a longer survival compared to classic onset ALS. Signs and symptoms [ ] The disorder causes muscle weakness and throughout the body due to the degeneration of the and. Individuals affected by the disorder may ultimately lose the ability to initiate and control all voluntary movement, although bladder and bowel function and the are usually spared until the final stages of the disorder.

Or behavioral dysfunction is present in 30–50% of individuals with ALS. Around half of people with ALS will experience mild changes in cognition and behavior, and 10–15% will show signs of., apathy, and are frequently reported behavioral features of ALS.,, and troubles with and are the most commonly reported cognitive symptoms in ALS; a meta-analysis found no relationship between dysfunction and disease severity. However, cognitive and behavioral dysfunctions have been found to correlate with reduced survival in people with ALS and increased caregiver burden; this may be due in part to deficits in social cognition. About half the people who have ALS experience, in which they cry or laugh for no reason. And the are generally unaffected, meaning the majority of people with ALS maintain,,,, and. Initial symptoms [ ] The start of ALS may be so subtle that the symptoms are overlooked. The earliest symptoms of ALS are muscle weakness or muscle atrophy.

Other presenting symptoms include trouble swallowing or breathing, cramping, or stiffness of affected muscles; muscle weakness affecting an arm or a leg; or slurred and nasal speech. The parts of the body affected by early symptoms of ALS depend on which motor neurons in the body are damaged first. In limb-onset ALS, people first experience awkwardness when walking or running or even tripping over or stumbling may be experienced and often this is marked by walking with a ' which drags gently on the ground. Or if arm-onset, difficulty with tasks requiring manual dexterity such as buttoning a shirt, writing, or turning a key in a lock may be experienced.

In bulbar-onset ALS, initial symptoms will mainly be of difficulty speaking clearly or swallowing. Speech may become slurred, nasal in character, or quieter. There may be difficulty in swallowing and loss of tongue mobility. A smaller proportion of people experience 'respiratory-onset' ALS, where the that support breathing are affected first. Over time, people experience increasing difficulty moving, swallowing (), and speaking or forming words ().

Cutepdf Pro Silent Install Cmd on this page. Symptoms of upper motor neuron involvement include tight and stiff muscles () and exaggerated reflexes () including an overactive gag reflex. An abnormal reflex commonly called also indicates upper motor neuron damage. Symptoms of lower motor neuron degeneration include muscle weakness and atrophy, muscle cramps, and fleeting twitches of muscles that can be seen under the skin (fasciculations) although twitching is not a diagnostic symptom and more of a side effect so twitching would either occur after or accompany weakness and atrophy. Progression [ ] Although the order and rate of symptoms vary from person to person, the disease eventually spreads to unaffected regions and the affected regions become more affected. Most people eventually are not able to walk or use their hands and arms, lose the ability to speak and swallow food and their own saliva, and begin to lose the ability to cough and to breathe on their own. The rate of progression can be measured using an outcome measure called the 'ALS Functional Rating Scale Revised (ALSFRS-R)', a 12-item instrument administered as a clinical interview or self-reported questionnaire that produces a score between 48 (normal function) and 0 (severe disability); it is the most commonly used outcome measure in clinical trials and is used by doctors to track disease progression.

Though the degree of variability is high and a small percentage of people have a much slower disorder, on average, people with ALS lose about 0.9 FRS points per month. A survey-based study amongst clinicians showed that they rated a 20% change in the slope of the ALSFRS-R as being clinically meaningful.

Disorder progression tends to be slower in people who are younger than 40 at onset, are mildly obese, have disorder restricted primarily to one limb, and those with primarily upper motor neuron symptoms. Conversely, progression is faster and prognosis poorer in people with bulbar-onset disorder, respiratory-onset disorder, and frontotemporal dementia. The variants have also been shown to have an effect on the disorder's progression and life expectancy. Late stages [ ] Difficulty in chewing and swallowing makes eating very difficult and increases the risk of choking or of aspirating food into the lungs.

In later stages of the disorder, can develop, and maintaining a healthy weight can become a significant problem that may require the insertion of a feeding tube. As the diaphragm and of the that support breathing weaken, measures of such as and inspiratory pressure diminish. In respiratory-onset ALS, this may occur before significant limb weakness is apparent. Most people with ALS die of respiratory failure. Although respiratory support can ease problems with breathing and prolong survival, it does not affect the progression of ALS.

Most people with ALS die between two and four years after the diagnosis. Around half of people with ALS die within 30 months of their symptoms beginning, and about 20% of people with ALS live between 5 years and 10 years after symptoms begin. Guitarist has lived since 1989 with the disorder, while has survived for more than 50 years through 2017, but they are considered unusual cases.

Most people with ALS die in their own home, with their while they sleep; people rarely choke to death. Cause [ ] Genetics [ ]. Main article: About 5–10% of cases are directly inherited from a person's parents. Overall, of an individual with ALS have a 1% risk of developing ALS. A defect on, which codes for, is associated with about 20% of familial cases of ALS, or about 2% of ALS cases overall.

This mutation is believed to be transmitted in an manner, and has over a hundred different forms of mutation. The most common ALS-causing mutation is a mutant gene, seen in North America; this is characterized by an exceptionally rapid progression from onset to death. The most common mutation found in Scandinavian countries, D90A-SOD1, is more slowly progressive than typical ALS, and people with this form of the disorder survive for an average of 11 years. [ ] In 2011, a genetic abnormality known as a hexanucleotide repeat was found in a region called, which is associated with ALS combined with frontotemporal dementia ALS-FTD, and accounts for some 6% of cases of ALS among white Europeans. Head injury [ ] While moderate to severe is a risk for ALS, it is unclear if mild traumatic brain injury increases rates. In 1994 the (NIOSH) reported a nonsignificant increase in nervous system disorders due to four cases of ALS among (NFL) players.

It was unclear if this was due to chance or not. Another study from 2012 also found a possible increase in ALS in NFL football players.

An older study did not find an increased risk among high school football players. A 2007 review found an increased risk among soccer players. ALS may also occur more often among the US military veterans however the reason is unknown. This may be due to head injury. After the 2012 report was released, some NFL players involved in the legal settlement with the NFL complained that the NFL, which initially agreed to pay $765 million, was not doing enough to help players. The judge in the case concurred, and the NFL then agreed to pay an unlimited amount of damages for players found to have ALS,, and dementia. Other factors [ ] Where no family history of the disease is present – around 90% of cases – no cause is known.

Possible associations for which evidence is inconclusive include military service and smoking. Although studies on military history and ALS frequency are inconsistent, there is weak evidence for a. Various proposed factors include exposure to (inferred from geographical deployment studies), as well as alcohol and tobacco use during military service. In a 2017 study analyzing deaths from 1985 to 2011, occupations correlated with ALS deaths were, such as in management, financial, architectural, computing, legal, and education jobs. Other potential risk factors remain unconfirmed, including chemical exposure, electromagnetic field exposure, occupation, physical trauma, and electric shock. There is a tentative association with exposure to various, including the,,, and.

Pathophysiology [ ] The defining feature of ALS is the death of both and in the of the brain, the brain stem, and the spinal cord. Prior to their destruction, motor neurons develop protein-rich in their cell bodies and. This may be partly due to defects in protein degradation.

These inclusions often contain, and generally incorporate one of the ALS-associated proteins: SOD1, (TDP-43, or TARDBP),. The mutant SOD1 may also contribute to motor neuron cell death through generating free radicals., or cell death caused by high levels of intracellular calcium caused by excessive activity of excitatory neurotransmitters, may be a mechanism of ALS.

This concept has been supported by increased glutamate and dysfunctional – in of those with ALS. This is further supported by the only effective treatment being an anti-glutaminergic drug (), as well as the poor ability to buffer calcium in motor neurons relative to other neurons. Neurofilament accumulation in axons has been observed in sporadic cases of ALS as well as in SOD1 patients, possibly interfering with, leading to cell death from SOD1 toxicity.

Diagnosis [ ]. MRI (axial ) demonstrates increased signal within the, consistent with the diagnosis of ALS.

No test can provide a definite diagnosis of ALS, although the presence of upper and lower motor neuron signs in a single limb is strongly suggestive. Instead, the diagnosis of ALS is primarily based on the symptoms and signs the observes in the person and a series of tests to rule out other diseases.

Physicians obtain the person's full and usually conduct a neurologic examination at regular intervals to assess whether symptoms such as muscle weakness, atrophy of muscles,, and spasticity are worsening. Differential diagnosis [ ] Because symptoms of ALS can be similar to those of a wide variety of other, more treatable diseases or disorders, appropriate tests must be conducted to exclude the possibility of other conditions. One of these tests is (EMG), a special recording technique that detects electrical activity in muscles. Certain EMG findings can support the diagnosis of ALS. Another common test measures (NCV).

Specific abnormalities in the NCV results may suggest, for example, that the person has a form of (damage to peripheral nerves) or (muscle disease) rather than ALS. While a (MRI) is often normal in people with early stage ALS, it can reveal evidence of other problems that may be causing the symptoms, such as a spinal cord tumor,, a disk in the neck,, or cervical.

Based on the person's symptoms and findings from the examination and from these tests, the physician may order tests on blood and samples to eliminate the possibility of other diseases, as well as routine laboratory tests. In some cases, for example, if a physician suspects the person may have a myopathy rather than ALS, a muscle biopsy may be performed. Such as human immunodeficiency virus (), human T-cell leukemia virus (),, and can in some cases cause ALS-like symptoms. Neurological disorders such as multiple sclerosis,,,,, and can also mimic certain aspects of the disease and should be considered. ALS must be differentiated from the 'ALS mimic syndromes' which are unrelated disorders that may have a similar presentation and clinical features to ALS or its variants. Because of the prognosis carried by this diagnosis and the variety of diseases or disorders that can resemble ALS in the early stages of the disease, people with ALS symptoms should always obtain a specialist neurological opinion in order to rule out alternative diagnoses., also known as Lambert–Eaton syndrome, can mimic ALS, and its initial presentation can be similar to that of (MG), a treatable autoimmune disease sometimes mistaken for ALS. Is another condition that mimics some of the early symptoms of ALS but is accompanied by normal EMG readings and no major disablement.

Most cases of ALS, however, are correctly diagnosed, with the error rate of diagnosis in large ALS clinics is less than 10%. One study examined 190 people who met the MND/ALS diagnostic criteria, complemented with laboratory research in compliance with both research protocols and regular monitoring. Thirty of these people (16%) had their diagnosis completely changed during the clinical observation development period. In the same study, three people had a false negative diagnosis of MG, which can mimic ALS and other neurological disorders, leading to a delay in diagnosis and treatment. MG is eminently treatable; ALS is not.

Management [ ] Management of ALS attempts to relieve symptoms and extend life expectancy. This supportive care is best provided by multidisciplinary teams of healthcare professionals working with the person and their caregivers to keep them as mobile and comfortable as possible. [ ] Medications [ ] has been found to modestly prolong survival by approximately two to three months.

It may have a greater survival benefit for those with a onset. It is approved by the US (FDA) and recommended by the (England and Wales).

Riluzole does not reverse damage already done to motor neurons but affects neurons by reducing their activity through blocking Na+ entrance into the neurons and thus blocking the release of the chemicals that causes the activity of the motor neurons. The reduction in activity prevents the ruining of the neuronal muscle and so the drug can act as a protective chemical. Studies have shown that the function of this drug is dependent on the amount taken at a given time. The higher the concentration, the better the drug will protect the neurons from ruin. The recommended dosage of Riluzole is 50 mg, twice a day for people with known ALS for more than 5 years. There are a number of side effects caused by the drug including the feeling of weakness in muscles but this is normal due to the function of the drug.

Studies have shown that people on the drug are not likely to stop responding to it or develop symptoms that might cause the activity of neurons to rise again, making Riluzole an effective drug for prolonging survival. In 2015, was approved in Japan for treatment of ALS after studying how and whether it works on 137 people with ALS and has obtained status in the EU and USA. On May 5, 2017, the FDA approved edaravone to extend the survival period of people with ALS. It costs about 145,000 USD per year in the US and 35,000 USD per year in Japan. Other medications may be used to help reduce fatigue, ease muscle cramps, control spasticity, and reduce excess saliva and.

Drugs also are available to help people with pain, such as non-steroidal and anti-inflammatory drugs and opioids, depression, sleep disturbances, dysphagia, and constipation. And are often prescribed to control the spasticity caused by ALS, and, or most commonly glycopyrrolate may be prescribed when people with ALS begin having trouble swallowing their saliva.

There is no evidence that medications are effective at reducing muscle cramps experienced by people with ALS. Breathing support [ ] Respiratory failure is the most common cause of death in people with ALS and is the most prominent symptom, second to the destruction of motor neurons and weakening of muscle. When the muscles that assist in breathing weaken, several symptoms start to arise including shortness of breath when undergoing physical activity or talking, fatigue, morning headaches, poor concentration and depression. The use of ventilatory assistance (, (BiPAP), or (BCV) may be used to aid breathing.

Such devices artificially inflate the person's lungs from various external sources that are applied directly to the face or body. When muscles are no longer able to maintain oxygen and carbon dioxide levels, these devices may be used full-time. BCV has the added advantage of being able to assist in clearing secretions by using high-frequency oscillations followed by several positive expiratory breaths. People may eventually consider forms of mechanical ventilation (respirators) in which a machine inflates and deflates the lungs. To be effective, this may require a tube that passes from the nose or mouth to the windpipe () and for long-term use, an operation such as a, in which a plastic is inserted directly in the person's windpipe through an opening in the neck. [ ] Persons and their families should consider several factors when deciding whether and when to use one of these options.

Ventilation devices differ in their effect on the person's quality of life and in cost. Although ventilation support can ease problems with breathing and prolong survival, it does not affect the progression of ALS. People need to be fully informed about these considerations and the long-term effects of life without movement before they make decisions about ventilation support and have deep discussions on quality of life. Some persons under long-term tracheostomy intermittent positive pressure ventilation with deflated cuffs or cuffless tracheostomy tubes (leak ventilation) are able to speak, provided their bulbar muscles are strong enough, though in all cases speech will be lost as the disease progresses. This technique preserves speech in some persons with long-term mechanical ventilation.

Other persons may be able to use a speaking valve such as a Passey-Muir speaking valve with the assistance and guidance of a speech-language pathologist. [ ] External ventilation machines that use the ventilation mode of BiPAP are frequently used to treat respiratory insufficiency at night, and later during the daytime. The use of BPAP (more often referred to as noninvasive ventilation, NIV) has shown to prolong survival and slow down the progression of forced vital capacity but long before BPAP stops being effective, persons should decide whether to have a and long-term mechanical ventilation.

At this point, some persons choose. [ ] Therapy [ ]. Using low tech to communicate.

A man with ALS communicates by pointing to letters and words using a head mounted laser pointer. Plays a large role in rehabilitation for individuals with ALS. Specifically, physical, occupational, and speech therapists can set goals and promote benefits for individuals with ALS by delaying loss of strength, maintaining endurance, limiting pain, improving speech and swallowing, preventing complications, and promoting functional independence. Occupational therapy and special equipment such as can also enhance people's independence and safety throughout the course of ALS. Gentle, low-impact such as performing activities of daily living, walking, swimming, and can strengthen unaffected muscles, improve cardiovascular health, and help people fight fatigue and depression.

Range of motion and stretching exercises can help prevent painful and shortening (contracture) of muscles. Physical and occupational therapists can recommend exercises that provide these benefits without overworking muscles because muscle exhaustion can lead to worsening of symptoms associated with ALS rather than provide help to people with ALS. They can suggest devices such as ramps, braces, walkers, bathroom equipment (shower chairs, toilet risers, etc.), and wheelchairs that help people remain mobile.

Occupational therapists can provide or recommend equipment and adaptations to enable ALS people to retain as much safety and independence in activities of daily living as possible. People with ALS who have difficulty speaking may benefit from working with a. These health professionals can teach people adaptive strategies such as techniques to help them speak louder and more clearly. As ALS progresses, speech-language pathologists can recommend the use of such as voice amplifiers, speech-generating devices (or voice output communication devices) or low-tech communication techniques such as head mounted laser pointers, or yes/no signals. Nutrition [ ] People with ALS and caregivers can learn from dieticians how to plan and prepare numerous small meals throughout the day that provide enough calories, fiber and fluid, and how to avoid foods that are difficult to swallow. Providing meals with vitamin E and taking vitamin E supplements have shown to slow down the progression of ALS. People may begin using suction devices to remove excess fluids or saliva and prevent choking.

Occupational therapists can assist with recommendations for adaptive equipment to ease the physical task of self-feeding. Speech-language pathologists make food choice recommendations that are more conducive to their unique deficits and abilities. When people with ALS can no longer get enough nourishment from eating, doctors may advise inserting a into the stomach. The use of a feeding tube also reduces the risk of choking and pneumonia that can result from inhaling liquids into the lungs. The tube is not painful and does not prevent people from eating food orally if they wish. [ ] Researchers have stated, 'ALS patients have a chronically deficient intake of energy and recommended augmentation of energy intake' and have a severe loss of appetite. Both animal and human research [ ] [ ] suggest that ALS patients should be encouraged to consume as many calories as possible and not to restrict their caloric intake.

As of 2012, 'a lack of robust evidence for interventions' remained for the management of weight loss. [ ] End of life care [ ] and home care and nurses help people with ALS, their families, and caregivers with the medical, emotional, and financial challenges of coping, particularly during the final stages of the disease. Social workers provide support such as assistance in obtaining financial aid, arranging durable, preparing a, and finding support groups for patients and caregivers. Home nurses are available not only to provide medical care, but also to teach caregivers about tasks such as maintaining respirators, giving feedings, and moving people to avoid painful skin problems and contractures. Home hospice nurses work in consultation with physicians to ensure proper medication, pain control, and other care affecting the quality of life of people with ALS who wish to remain at home. The home hospice team can also counsel people with ALS and caregivers about end-of-life issues.

[ ] Epidemiology [ ] In much of the world, rates of ALS are unknown. Download Drivers Encore N150. In Europe, the disease affects about 2.2 people per 100,000 per year.

In the United States, more than 5,600 are diagnosed every year (over 1.87 per 100,000 per year), and up to 30,000 Americans are currently affected. ALS is responsible for two deaths per 100,000 people per year.

ALS is classified as a rare disease, designated by the FDA as an 'orphan' disease (affecting fewer than 200,000 people in the United States), but is the most common motor neuron disease. People of all races and ethnic backgrounds are affected. One or two of 100,000 people develop ALS each year. Amyotrophic lateral sclerosis affects around 30,000 Americans.

ALS cases are estimated at 1.2–4.0 per 100,000 individuals in Caucasian populations with a lower rate in other ethnic populations. Are second to Caucasians in terms of ALS prevalence with 1.1-2.8 per 100,000 individuals. Reports have been made of several 'clusters' including three players from the, more than 50 players in Italy, three association football-playing friends in the south of England, and conjugal (husband and wife) cases in the south of France. Although many authors consider ALS to be caused by a combination of genetic and environmental risk factors, so far the latter have not been firmly identified, other than a higher risk with increasing age. History [ ] Descriptions of the disease date back to at least 1824.

English scientist described the appearance of shriveled nerve fibers in 1850. In 1869, the connection between the symptoms and the underlying neurological problems were first described by, who initially introduced the term amyotrophic lateral sclerosis in his 1874 paper. In 1881, the article was translated into English and published in a three-volume edition of Lectures on the Diseases of the Nervous System. ALS became a in the United States in 1939 when baseball legend 's career, and two years later, his life, were ended by the disease. In the 1950s, an occurred among the on which bore similarities to many conditions, including ALS.

By 1991, researchers had linked chromosome 21 to familial ALS (FALS). In 1993, the SOD1 gene on chromosome 21 was found to play a role in some cases of FALS. In 1996, riluzole became the first FDA-approved drug for ALS. [ ] In 1998, the El Escorial criteria were developed as the standard for classifying people with ALS in clinical research.

The next year, the revised ALS Functional Rating Scale was published and soon becomes a gold standard for clinical research. Noncoding repeat expansions in were found to be a major cause of ALS and frontotemporal dementia in 2011. [ ] Name [ ] Amyotrophic comes from the word: a- means 'no', myo refers to 'muscle', and trophia means 'nourishment'; amyotrophia therefore means 'no muscle nourishment,' which describes the characteristic of the sufferer's disused muscle tissue. Lateral identifies the areas in a person's spinal cord where affected portions of the nerve cells are located. Degeneration in this area leads to scarring or hardening (').

In countries, the term 'motor neurone disease' (MND) is commonly used. Society and culture [ ]. A student demonstrating the ice bucket challenge In August 2014, a challenge went online which was commonly known as the '. Contestants fill a bucket full of ice and water, then state who nominated them to do the challenge, and nominate three other individuals of their choice to take part in it.

The contestants then dump the buckets of ice and water onto themselves. However, it can be done in a different order.

The contestants then donate at least 10 (or a similar amount in their local currency) to ALS research at the, the, or in the UK. Any contestants who refuse to have the ice and water dumped on them are expected to donate at least US$100 to ALS research. As of July 2015, the Ice Bucket Challenge had raised $115 million for the ALS Association.

Many celebrities have taken part in the challenge. The Ice Bucket Challenge was credited with helping to raise funds that contributed to the discovery that the gene may potentially contribute to the development for ALS.

ALS has been discussed and depicted late in the second season of science fiction series, particularly in episode 'Epilogue (Part 2)', which first aired on 25 April 2011. ALS is the central topic of the 2014 movie, directed by, with, and playing the main characters.

's, covered ALS in Season 4 Episode 16: Die Trying. Research [ ]. Main article: Repetitive had been studied in ALS in small and poorly designed clinical trials; as of 2013, there was insufficient evidence to know whether rTMS is safe or effective for ALS. One 2016 review of trials found tentative evidence that intraspinal stem cell implantation was relatively safe and possibly effective. A 2016 of cell based therapies found that there was insufficient evidence to speculate about efficacy. Stem cell therapy can provide additional proteins and enzymes that have shown to help prolong survival and control the symptoms associated with ALS. Those proteins include neurotrophic factors and insulin-like growth factor 1.

Both those proteins are still under clinical trials and need to be further studied to evaluate their efficiency and associated side effects. Has been approved as an in Europe and the United States with studies ongoing as of 2016. Medications tested but without evidence for efficacy include,,,,,,,,, various neurotrophic factors, which has shown promise in both in-vitro and in-vivo models of ALS but is yet to be effective in human models of ALS and creatine. Drugs have been proposed as a treatment for their effects on muscle growth and neuroprotection, but there is insufficient research in humans to determine their efficacy.

References [ ].

GGGGCC repeat expansions in the C9orf72 gene have been identified as a major contributing factor in patients with amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Given the overlapping of clinical phenotypes and pathological characteristics between these two diseases and Alzheimer's disease (AD), Parkinson's disease (PD), and essential tremor (ET), we speculated regarding whether C9orf72 repeat expansions also play a major role in these three diseases. Using the repeat-primed polymerase chain reaction method, we screened for C9orf72 in three groups of patients with PD ( n = 911), AD ( n = 279), and ET ( n = 152) in the Chinese Han population. There were no pathogenic repeats (>30 repeats) detected in either the patients or controls ( n = 314), which indicated that the pathogenic expansions of C9orf72 might be rare in these three diseases.

However, the analysis of the association between the number of repeats ( p = 0.001), short/intermediate genotype (short. Introduction A hexanucleotide (GGGGCC) repeat expansion in the first intron of the C9orf72 gene was recently identified as a major contributing factor to the chromosome 9p21-linked diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (Dejesus-Hernandez et al., ). As previously reported, the C9orf72 mutation accounts for 23.5–47% of familial ALS/FTD and 4.1–21.0% of sporadic ALS in white populations (Dejesus-Hernandez et al.,; Renton et al.,; Gijselinck et al., ). The pathogenic mechanism of repeat expansions primarily includes interference with the normal expression of the encoded protein or the loss of protein function through the generation of abnormal toxic RNA foci that disrupt normal cellular pathways (Renton et al.,; Sha and Boxer, ). There is no doubt that the overlapping presentations of clinical phenotypes, pathological characteristics, and gene mutations exist among Parkinson disease (PD), Alzheimer's disease (AD), and ALS/FTD (Hudson,; Piguet et al.,; Arighi et al.,; Floris et al.,; O'Dowd et al., ). First, in the examination of clinical phenotypes, relatives of patients with ALS have an increased risk for developing PD and AD, additionally, some ALS/FTD patients have developed the associated features of Parkinsonism and movement disorders (Hsiung et al.,; Takada et al.,; Kohli et al., ).

Second, the presence of TAR DNA-binding protein-43(+) intranuclear inclusions, which are the pathological feature of chromosome 9p21-linked ALS/FTD, have been detected in PD and AD patients (Nakashima-Yasuda et al.,; Boeve et al., ). Finally, mutations in the microtubule-associated protein tau (MAPT) gene could cause a spectrum of phenotypes which include ALS, Parkinsonism, and cognitive impairment (O'Dowd et al., ). Given the considerations above, one question has yet to be addressed. Could the C9orf72 repeat expansions account for other neurodegenerative disorders, such as AD, PD, and essential tremor (ET)? In C9orf72, Repeat expansions exceeding 30 units have been suggested to be pathological in ALS/FTD patients (Dejesus-Hernandez et al., ). Interestingly, pathogenic expansions have also been observed in patients with PD, AD, progressive supranuclear palsy, corticobasal degeneration, and Lewy body dementia (Xi et al.,; Cacace et al.,; Lesage et al., ), which further indicates that the phenotypes that are associated with repeat expansions could include the spectrum of cognitive impairment and movement disorder syndromes.

In addition, a previous study has demonstrated that the role of intermediate repeats (7–24 repeat units) is strongly associated with these diseases and the expression of C9orf72. The significantly decreased transcriptional activity of C9orf72 with an increasing number of normal repeats indicates that intermediate repeats may act as predisposing alleles and favors the loss-of-function disease mechanism (Van Der Zee et al., ). In this study, we first assess the prevalence of C9orf72 repeat expansions in a large cohort of Chinese Han patients with AD, PD, or ET to determine whether repeat expansions play a role in these three common disorders. Furthermore, we explore whether repeat expansions of intermediate repeats might be a risk factor for AD, PD, or ET, and/or could affect the age at onset in patients with these three diseases.

Study samples Three independent series of patients participated in this study: the first cohort of 911 sporadic PD patients that met the UK brain bank diagnosis criteria (Hughes et al., ); the second cohort of 279 sporadic AD patients that met the NINCDS-ADRDA criteria for probable or definite AD (McKhann et al., ); and the third cohort of 152 ET patients that met the Washington Heights-Inwood Genetic Study of ET (WHIGET) diagnosis criteria (Louis et al., ). All patients were recruited from the outpatient neurology clinics of the Xiangya Hospital, Central South University. In total, 314 healthy Chinese individuals were recruited from the Xiangya Wellness Center as a control group. Informed consents for participation in the study were obtained from all subjects, including patients and controls. This study received prior approval by the institutional review board and the ethics committee of the Xiangya Hospital, Central South University. Methods Genomic DNA was isolated from peripheral blood leukocytes using a QIAGEN kit. We screened the presence of the GGGGCC hexanucleotide expansion of C9orf72 using a 2-step polymerase chain reaction protocol.

In the first step, we used a previously reported repeat-primed polymerase chain reaction assay to detect the size of the larger expanded alleles (Dejesus-Hernandez et al., ). Briefly, DNA samples (50 ng/μ l) were amplified using three primers (MRX-F: 5′FAM-ACAGTACTCGCTGAGGGTGAAC; MRX-R1: 5′CAGGAAACAGCTATGACCGGGCCCGCCCCGACCACGCCCCGGCCCCGGCCCCGG; MRX-M13R: 5′CAAGGAAACAGCTATGACC), and the primers ratio (0.6 μ l of 10 μ M of MRX-F; 0.6 μ l of 10 μ M of MRX-M13R; 0.1 μ l of 10 μ M of MRX-R1) were modified to improve the efficiency of the PCR. Other components of the PCR reaction included the following: 1_μ l of 50_ng/μ l of DNA samples, 2_μ l of 5× Q-solution (QIAGEN Valencia, CA, USA), 0.7 μ l of 100% DMSO (Sigma-Aldrich), 0.36 μ l of 7-deaza-dGTP (New England Biolabs, Ipswich, MA, USA), 0.2 μ l of Roche FastStart Taq DNA polymerase, 0.2 μ l of 10 μ M dNTP and 1 μ l of 10× Buffer (Roche Applied Science, Indianapolis, IN, USA), and 3.24 μ l MQ. The total process was performed using a touchdown thermocycling program. The reaction conditions consisted of 95°C for 5 min, 15 cycles of 95°C for 1 min, 70°C for 1 min, with a decrement of 1°C per cycle, 72°C for 3 min, followed by 25 cycles of 95°C for 1 min, 56°C for 1 min, 72°C for 3 min, 72°C for 60 min, the final temperature was then sustained at 15°C.

In the second step, we performed a classical FAM-fluorescent labeled PCR assay to detect the accurate genotype of the non-pathogenic mutation carriers. The fragment length analysis was performed on an ABI 3730×l DNA analyzer and was visualized by the GeneMapper software version 3.2 (Applied Biosystems).

Statistical analysis A cut-off value of 30 repeats was used to define the pathogenic threshold (Renton et al., ). One DNA sample of an ALS patient who was recruited from the Xiangya Hospital was subjected to a repeat-primed polymerase chain reaction, and >30 repeat expansions were detected (unpublished paper), which could verify the reliability and trustworthiness of our experiment. Descriptive statistics were expressed as the mean ± the standard deviation; differences in the distributions of repeat number between the patients and controls were tested using a 2-tailed Mann-Whitney U-test or Kruskal–Wallis H-test, and significance was set at p = 0.05. Considering that the role of ≥7 units in non-pathogenic carriers was strongly correlated with C9orf72 expression (Van Der Zee et al., ), all subjects were classified into three genotypes, including S/S, S/I, and I/I (S: short allele. Results Table presents the demographic information for our study.

A total of 1342 patients and 314 healthy controls were successfully subjected to repeat-primed polymerase chain reactions and genotyping. However, no pathological repeat expansion of C9orf72 was detected in either patients or controls.

The wide range of repeat expansions in patients was 2–27 units, and the most frequent repeats in all subjects was 2 units, followed by 6, 7, and 8; however, three PD patients harbored marginally larger alleles at 22, 23, and 27 units. In addition, the distributions of repeat numbers in the individuals' larger allele indicated a significant difference in PD ( p = 0.01), late onset PD (>50 years) ( p = 0.01), and male PD ( p = 0.03) when compared with controls.

However, no statistical significance was found in AD ( p = 0.67), ET ( p = 0.13) or their subtypes when compared with control individuals (Figure and Table ). Analysis of the distributions of repeat expansion in cases with different classification.

Given the significant distinction of repeat length in PD and control individuals, 202 PD patients who completed a battery of neuropsychological tests that were recommended by the Movement Disorder Society (MDS) Task Force, were further divided into 70 PD dementia (PD-D), 58 PD mild cognitive impairment (PD-MCI), and 74 PD with no cognitive impairment (PD-NC) according to the MDS Task Force diagnosis criteria(Dubois et al., ). However, no significant difference in the distribution of repeats was found among the three subgroups and control individuals ( p = 0.98) using Kruskal–Wallis H-test. In addition, we employed two analytical approaches for association testing, the larger repeat allele as a continuous variable and three genotyping categorical variables based on the individual's short or intermediate alleles. We did not identify any significant evidence of associations between the number of repeat and either the AD or ET risk or the age at onset in patients with PD or ET. Interestingly, we observed a statistically significant result between the I/I genotype and the age at onset ( p = 0.007; Regression coefficient 5.50 [0.27, 10.74]) after Bonferroni adjustment for multiple testing, but not in the continuous variable ( p = 0.93) (Table ). Finally, the only significant evidence of association was found between the repeat length and PD risk after using Bonferroni adjustment when considering repeats as a continuous variable ( p = 0.001, OR 1.06 [1.01, 1.10]), or when considering three genotypes as a categorical variable ( p = 0.0081; S/I: OR 1.37 [1.05, 1.79]; I/I: OR 2.03 [1.17, 3.54]) (Table ). Discussion Recently, GGGGCC repeat expansions in the C9orf72 gene were identified as major contributing factors for ALS and FTD.

However, the preliminary evidence suggested that the C9orf72 mutation rates in patients with clinically diagnosed ALS in China, Japan, Korea, and Taiwan were much lower than that observed in Caucasian populations (Ogaki et al.,; Tsai et al.,; Zou et al.,; Jang et al., ), which implied that the number of repeats varied greatly due to different nationalities and ethnicities. Given the clinical heterogeneity with the repeat expansions, we hypothesized that the length of repeats may also account for other neurodegenerative disorders. To investigate the hexanucleotide repeat expansions of C9orf72 on different genetic backgrounds, we screened for C9orf72 in a large group AD, PD, and ET patients with Chinese Han origin. To the best of our knowledge, this study is the first reported investigation of C9orf72 repeat expansions in three cohorts of patients in Asia. In this study, no pathogenic expansion was observed in either patients or controls, which supported recent data from other independent cohorts.

Across these studies, no abnormal repeats were found in 781 patients with PD and 568 patients with AD (Majounie et al.,; Rollinson et al., ). The relation between AD, PD, and C9orf72 has been controversial. Several studies have reported that pathogenic repeats were found in 0.7% patients with PD and in less than 1% of clinically diagnosed AD patients (Majounie et al.,; Xi et al., ). However, Majounie et al. Speculated that the positive results in AD patients might be an incidental rather than a causative finding due to amnesic FTD being misdiagnosed as probable AD (Majounie et al., ).

There are three possible explanations for our negative results. The first possibility is that the hexanucleotide repeat expansions could not cause PD, AD, or ET, and is only specific to ALS/FTD. Although the pathogenic gene mutations were detected in several probable cases of PD or AD, the exact diagnoses of these diseases should be confirmed due to clinical heterogeneity. Another explanation for the result is that the cut-off value of repeat >30 units that is suitable for ALS/FTD is most likely not suitable for AD, PD, or ET patients, and more samples should be included to set a solid cut-off value.

Finally, Mok et al. Found that the ALS/FTD patients with C9orf72 pathogenic repeats share a similar risk haplotype with Finland, Ireland, Italy, UK, and USA populations. Moreover, an investigation from Japan suggests that the pathogenic expansion is closely tied to the risk haplotype, and the low frequency of the risk haplotype might explain the low frequency of repeat expansions (Konno et al., ). Although no pathogenic expansion was observed in this study, we identified a significant association between the number of intermediate repeats and PD risk, which indicates that the more intermediate repeats, the greater risk of susceptibility to PD. As we know, this study is the first to raise this notion. This notion suggests that the intermediate alleles act as a contributor to PD risk.

Although our research to elucidate the disease mechanism of this intermediate repeat remains in its infancy, one previous study has indicated that intermediate repeats could decrease the transcriptional activity of C9orf72 (Van Der Zee et al., ). Therefore, how the intermediate alleles act as predisposing alleles and what is the pathogenic pathway of intermediate alleles in PD patients should be addressed in further studies. In addition, this study reported that there was no significant difference in repeat expansions among PDD, PD-MCI, PD-NC patients, and control individuals, which indicated that the number of repeats in C9orf72 might not account for the occurrence and severity of cognitive syndromes in PD patients. Recently, Kohli et al. () found nine AD patients that carried the C9orf72 mutation with an average disease onset of 77.8 years (all older than 60 years), and speculated that the pathogenic repeat expansions were most likely associated with late onset AD (>65 years). Similarly, in this study, we observed a positive correlation between the I/I genotype and the age at onset, which indicated that AD patients who carried I/I genotypes were susceptible to a higher age at onset. At present, APOE4 is the only major genetic risk factor for the development of late onset AD (Hauser and Ryan, ), if the relation above exists, then future research will focus on exploring whether there is an interaction mechanism between these two genes in patients with late onset AD.

Finally, there was only a cohort of 106 ET patients that were investigated before our study, and this cohort had the identical result as our study, with no association of normal repeat length with disease risk or with an effect on age at onset, further confirming that GGGGCC repeats did not play a role in patients with ET. However, there are several limitations in this work. First, an association between the I/I genotype and the age at onset in AD patients might be a false positive observation due to the lack of a statistically significance correlation between the larger alleles (continuous variables) and the age at onset.

Therefore, we should recruit more samples to verify the relation between the repeat expansions in C9orf72 and the age at onset in patients with AD. Second, if the relation above was further verified, then we should assess the relation between the C9orf72 repeats and APOE genotypes to explore whether there is an interaction mechanism between them.

Third, this study only examined sporadic AD, PD, and ET patients, C9orf72 may play a role in dominant familial forms. In conclusion, no C9orf72 pathogenic mutations in AD, PD, and ET patients in this study are consistent with previous studies (Majounie et al.,; Dejesus-Hernandez et al., ). However, we identified a statistically significant association between the intermediate repeats and PD risk, which implied that intermediate genotypes or alleles might be a risk factor for PD in China. Meanwhile, the lack of association between the intermediate repeats and AD risk has indicated that intermediate genotypes or alleles might play a different role in AD and PD.

• Arighi A., Fumagalli G. G., Jacini F., Fenoglio C., Ghezzi L., Pietroboni A. Early onset behavioral variant frontotemporal dementia due to the C9ORF72 hexanucleotide repeat expansion: psychiatric clinical presentations. Alzheimers Dis.

31, 447–452 [] • Boeve B. F., Boylan K.

B., Graff-Radford N. R., Dejesus-Hernandez M., Knopman D. S., Pedraza O., et al. Characterization of frontotemporal dementia and/or amyotrophic lateral sclerosis associated with the GGGGCC repeat expansion in C9ORF72.

Brain 135, 765–7/brain/aws004 [] [] [] • Cacace R., Van Cauwenberghe C., Bettens K., Gijselinck I., Van Der Zee J., Engelborghs S., et al. C9orf72 G(4)C(2) repeat expansions in Alzheimer's disease and mild cognitive impairment. Aging 34, 1712.e1–1712.e7 10.1016/j.neurobiolaging.2012.12.019 [] [] • Dejesus-Hernandez M., Mackenzie I. L., Baker M., Rutherford N. Expanded GGGGCC hexanucleotide repeat in noncoding region of C9ORF72 causes chromosome 9p-linked FTD and ALS. Neuron 72, 245–2/j.neuron.2011.09.011 [] [] [] • Dejesus-Hernandez M., Rayaprolu S., Soto-Ortolaza A. I., Rutherford N.

J., Heckman M. G., Traynor S., et al. Analysis of the C9orf72 repeat in Parkinson's disease, essential tremor and restless legs syndrome. Parkinsonism Relat. 19, 198–2/j.parkreldis.2012.09.013 [] [] [] • Dubois B., Burn D., Goetz C., Aarsland D., Brown R.

Diagnostic procedures for Parkinson's disease dementia: recommendations from the movement disorder society task force. 22, 2314–23/mds.21844 [] [] • Floris G., Borghero G., Cannas A., Di Stefano F., Costantino E., Murru M. Frontotemporal dementia with psychosis, parkinsonism, visuo-spatial dysfunction, upper motor neuron involvement associated to expansion of C9ORF72: a peculiar phenotype? 259, 1749–17/s00415-012-6444-3 [] [] [] • Gijselinck I., Van Langenhove T., Van Der Zee J., Sleegers K., Philtjens S., Kleinberger G., et al. A C9orf72 promoter repeat expansion in a Flanders-Belgian cohort with disorders of the frontotemporal lobar degeneration-amyotrophic lateral sclerosis spectrum: a gene identification study. Lancet Neurol.

11, 54–/S1474-441-7 [] [] • Hauser P. Impact of apolipoprotein E on Alzheimer's disease. Alzheimer Res.

[Epub ahead of print]. Y., Dejesus-Hernandez M., Feldman H.

H., Sengdy P., Bouchard-Kerr P., Dwosh E., et al. Clinical and pathological features of familial frontotemporal dementia caused by C9ORF72 mutation on chromosome 9p.

Brain 135, 709–7/brain/awr354 [] [] [] • Hudson A. Amyotrophic lateral sclerosis and its association with dementia, parkinsonism and other neurological disorders: a review.

Brain 104, 217–2/brain/104.2.217 [] [] • Hughes A. J., Daniel S. E., Kilford L., Lees A. Accuracy of clinical diagnosis of idiopathic Parkinson's disease: a clinico-pathological study of 100 cases. 55, 181–1/jnnp.55.3.181 [] [] [] • Jang J.

Analysis of the C9orf72 hexanucleotide repeat expansion in Korean patients with familial and sporadic amyotrophic lateral sclerosis. Aging 34, 1311.e7–1319.e9 10.1016/j.neurobiolaging.2012.09.004 [] [] • Kohli M. A., John-Williams K., Rajbhandary R., Naj A., Whitehead P., Hamilton K., et al. Repeat expansions in the C9ORF72 gene contribute to Alzheimer's disease in Caucasians.

Aging 34, 1519.e5–1519.e/j.neurobiolaging.2012.10.003 [] [] [] • Konno T., Shiga A., Tsujino A., Sugai A., Kato T., Kanai K., et al. Japanese amyotrophic lateral sclerosis patients with GGGGCC hexanucleotide repeat expansion in C9ORF72. 84, 398–4/jnnp-2012-302272 [] [] • Lesage S., Le Ber I., Condroyer C., Broussolle E., Gabelle A., Thobois S., et al.

C9orf72 repeat expansions are a rare genetic cause of parkinsonism. Brain 136, 385–3/brain/aws357 [] [] [] • Louis E. D., Ottman R., Ford B., Pullman S., Martinez M., Fahn S., et al. The washington heights-inwood genetic study of essential tremor: methodologic issues in essential-tremor research. Neuroepidemiology 16, 124–1/000109681 [] [] • Majounie E., Abramzon Y., Renton A. E., Keller M.

F., Traynor B. J., Singleton A. Large C9orf72 repeat expansions are not a common cause of Parkinson's disease. Aging 33, 2527.e1–2527.e2 10.1016/j.neurobiolaging.2012.05.007 [] [] [] • Majounie E., Abramzon Y., Renton A.

E., Perry R., Bassett S. S., Pletnikova O., et al. Repeat expansion in C9ORF72 in Alzheimer's disease. 366, 283–2/NEJMc1113592 [] [] [] • McKhann G., Drachman D., Folstein M., Katzman R., Price D., Stadlan E. Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's Disease. Neurology 34, 939–9/WNL.34.7.939 [] [] • Nakashima-Yasuda H., Uryu K., Robinson J., Xie S.

X., Hurtig H., Duda J. Co-morbidity of TDP-43 proteinopathy in Lewy body related diseases. Acta Neuropathol. 114, 221–2/s00401-007-0261-2 [] [] • O'Dowd S., Curtin D., Waite A. J., Roberts K., Pender N., Reid V., et al.

C9ORF72 expansion in amyotrophic lateral sclerosis/frontotemporal dementia also causes parkinsonism. 27, 1072–10/mds.25022 [] [] [] • Ogaki K., Li Y., Atsuta N., Tomiyama H., Funayama M., Watanabe H., et al. Analysis of C9orf72 repeat expansion in 563 Japanese patients with amyotrophic lateral sclerosis.

Aging 33, 2527.e11–2526.e6 10.1016/j.neurobiolaging.2012.05.011 [] [] • Piguet O., Hornberger M., Mioshi E., Hodges J. Behavioural-variant frontotemporal dementia: diagnosis, clinical staging, and management. Lancet Neurol. 10, 162–1/S1474-449-4 [] [] • Renton A. E., Majounie E., Waite A., Simon-Sanchez J., Rollinson S., Gibbs J. A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron 72, 257–2/j.neuron.2011.09.010 [] [] [] • Rollinson S., Halliwell N., Young K., Callister J.

B., Toulson G., Gibbons L., et al. Analysis of the hexanucleotide repeat in C9ORF72 in Alzheimer's disease. Aging 33, 1846.e5–1846.e6 10.1016/j.neurobiolaging.2012.01.109 [] [] • Sha S. Treatment implications of C9ORF72. Alzheimers Res. 4, /alzrt149 [] [] [] • Takada L.

T., Pimentel M. L., Dejesus-Hernandez M., Fong J.

C., Yokoyama J. S., Karydas A., et al. Frontotemporal dementia in a Brazilian kindred with the c9orf72 mutation. 69, 1149–11/archneurol.2012.650 [] [] [] • Tsai C. A hexanucleotide repeat expansion in C9ORF72 causes familial and sporadic ALS in Taiwan. Aging 33, 2232.e11–2232.e/j.neurobiolaging.2012.05.002 [] [] • Van Der Zee J., Gijselinck I., Dillen L., Van Langenhove T., Theuns J., Engelborghs S., et al. A pan-european study of the C9orf72 repeat associated with FTLD: geographic prevalence, genomic instability, and intermediate repeats.

34, 363–3/humu.22244 [] [] [] • Xi Z., Zinman L., Grinberg Y., Moreno D., Sato C., Bilbao J. Investigation of C9orf72 in 4 neurodegenerative disorders. 69, 1583–15/archneurol.2012.2016 [] [] [] • Zou Z. Screening for C9orf72 repeat expansions in Chinese amyotrophic lateral sclerosis patients. 34, 1710.e5–1710.e6 10.1016/j.neurobiolaging.2012.03.014 [] [].